ykuL [2019-04-30 16:05:15]

unknown

Locus: BSU14130

Isoelectric point: 5.16

Molecular weight: 16.49 kDa

Protein length: 147 aa

Gene length: 444 bp

Function: unknown

Product: unknown

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Targets of second messengers → Targets of c-di-AMP
• Groups of genes → Proteins of unknown function

Gene

Coordinates: 1,485,453 1,485,896

The protein

Domains

• CBS domain (18-78)

Structure

• 1YAV

Expression and Regulation

Operons

• Genes: ykuJ-ykuK-abbA-darB-ccpC
  Description: PubMed

  Regulatory mechanism

  • Spo0A: activation, by Spo0A~P PubMed, in Spo0A regulon
  • CcpA: repression, PubMed, in CcpA regulon

  Regulation

  • expressed under conditions that trigger sporulation (Spo0A) PubMed

Biological materials

Mutant

• MGNA-A773 (ykuL::erm), available at the NBRP B. subtilis, Japan
• GP2769 (ΔdarB::ermC), available in Jörg Stülke's lab
• BKE14130 (ykuL::erm trpC2) available in the Bacillus Genetic Stock Center and in Jörg Stülke's lab PubMed
• GP214 (deletion of ykuJ-ykuK-abbA-darB, replaced by aphA3), available in Jörg Stülke's lab
• BKE14130 (darB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTTCGACCCCTTTTC, downstream forward: _UP4_TAGGCTGTACGGTCCTATTT
• BKK14130 (darB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTTCGACCCCTTTTC, downstream forward: _UP4_TAGGCTGTACGGTCCTATTT
• GP2800 (ΔdarB-ccpC]::phleo), available in Jörg Stülke's lab

Expression vectors

• pGP2929 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab
• pGP635: expression of Strep-ykuL by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP767: expression of ykuL-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP1550: expression of ykuL by pBQ200 in B. subtilis, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

FLAG-tag construct

• GP2810 ykuL-3xFLAG spc (based on pGP1331), available in Jörg Stülke's lab

References

Loading